Embedded Files
Click for detailed protocol.
To mutagenize zebrafish efficiently using the CRISPR/Cas9 system we need to inject RNA for both components of the system. We synthesize Cas9 mRNA simply by linearizing a vector and using an in vitro transcription kit. That mRNA is cleaned and is now ready for injection.
The gRNA that binds the genome at a specific location needs to be synthesized and needs to be easily customizable. We first design a CRISPR target sequence for our gene of interest. This is a 23bp sequence in the gene. The first 20bp of that sequence need to be included on the gRNA as well as an 80 nucleotide tail sequence that interacts with the Cas9 enzyme. To synthesize this gRNA molecule we do an overlap PCR using two oligos. A scaffold oligo contains the sequence that interacts with Cas9 and the guide oligo contains the gene specific sequence. That DNA is cleaned and used as template for an in vitro transcription reaction. That RNA is cleaned and is now ready for injection.
- Design a guide sequence target in your gene of interest. Use the 20bp binding site upstream of the NGG to create an oligo that will be used for making gRNA.
- Using the scaffold oligo (gatccgcaccgactcggtgccactttttcaagttgataacggactagccttattttaacttgctatttctagctctaaaac) in conjunction with a gene specific guide sequence oligo (aattaatacgactcactata[20bp Target Sequence]gttttagagctagaaatagc) , do an overlap PCR with each oligo templating off of each other.
- Clean the DNA and use it as the template for a T7 in vitro transcription reaction.
- Clean the gRNA. Spec a diluted sample. Mix with Cas9 mRNA to a specific concentration. Inject.
HRM is a quick way to ascertain the effectiveness of the CRISPR mutagenesis. The result in our hands is only qualitative and not very quantitative -- we can tell that the gRNA is working, but cannot measure how well it is working.
In the example below, the red lines represent WT and blue lines represent Injected animals. The blue melt curves very obviously have an extra melt earlier than the WT curves indicating shorter products (with potential InDel mutations) that are melting at lower temperatures.
Also, in the difference view, these injected animals segregate well from the WT.
Page updated
Report abuse