Showing 48 items
TargetSequenceEfficiencyMethodNotes
Sort 
 
Sort 
 
Sort 
 
Sort 
 
Sort 
 
TargetSequenceEfficiencyMethodNotes
cnsta GGCAGAGCGACGGCCCTGTAAGG 53.3 NGS InDel allele freq 1000pg Cas9, 12.5pg gRNA, pool of 8 gRNAs 
cnstb GGAGTCCGAAAGCAGGAAATCGG 67.4 NGS InDel allele freq 1000pg Cas9, 12.5pg gRNA, pool of 8 gRNAs 
cntn1a GAAGCCCGACTCACACTACCTGG 29.7 NGS InDel allele freq 1000pg Cas9, 12.5pg gRNA, pool of 8 gRNAs 
cntn1b GATGAGCACTTCAGCCTGGTTGG 18.7 NGS InDel allele freq 1000pg Cas9, 12.5pg gRNA, pool of 8 gRNAs 
cntn2 GGAGCGAGCCTGGCAGCTCAGGG 38.1 NGS InDel allele freq 1000pg Cas9, 12.5pg gRNA, pool of 8 gRNAs 
cntn3a GTGTCCTGCTCGACGAATGAGGG 35.5 NGS InDel allele freq 1000pg Cas9, 12.5pg gRNA, pool of 8 gRNAs 
cntn3b GTGTAATTCCCGACGTCGGACGG 57.4 qPCR abundance 1000pg Cas9, 12.5pg gRNA 
cntn4 GTACCCATCAATCGTGAAGCAGG 73.6 qPCR abundance 1000pg Cas9, 12.5pg gRNA 
cntn5 GCAAGCGAAGTCATCGATTATGG 60.5 qPCR abundance 1000pg Cas9, 12.5pg gRNA 
cntn6 GGCCGTCCGAGTGTCGCTGTTGG 29.3 NGS InDel allele freq 1000pg Cas9, 12.5pg gRNA, pool of 8 gRNAs 
cntnap1 GGGGAGGAAGTATCGTATTATGG 49.3 NGS InDel allele freq 1000pg Cas9, 12.5pg gRNA, pool of 8 gRNAs 
cntnap2 GTATCTGCCCTGCGTTGCGATGG 32.8 NGS InDel allele freq 1000pg Cas9, 12.5pg gRNA, pool of 8 gRNAs 
cntnap2a GGGGTGATTCTGCACGGAGAGGG 67.3 NGS InDel allele freq 1000pg Cas9, 12.5pg gRNA, pool of 8 gRNAs 
cntnap2b GAATGAAGTCGGGGTTGCCCAGG 42.8 NGS InDel allele freq 1000pg Cas9, 12.5pg gRNA, pool of 8 gRNAs 
cntnap4 GTCTCCAGCCAGGGCCGATACGG 68.5 NGS InDel allele freq 1000pg Cas9, 12.5pg gRNA, pool of 8 gRNAs 
cntnap5 GGACCTACGGGATAGGTTGAAGG 59.8 NGS InDel allele freq 1000pg Cas9, 12.5pg gRNA, pool of 8 gRNAs 
cntnap5a GGACAGGTCTCCTTGGCTGCAGG 54.3 NGS InDel allele freq 1000pg Cas9, 12.5pg gRNA, pool of 8 gRNAs 
cntnap5b GGTCACAGCTGTGGCGACCCAGG 23.7 NGS InDel allele freq 1000pg Cas9, 12.5pg gRNA, pool of 8 gRNAs 
gjd1a GAGAATGGACTATATTGGAGAGG 85.7 NGS InDel allele freq 1000pg Cas9, 12.5pg gRNA, pool of 8 gRNAs 
gjd1b GACCATTTTAGAGCGCCTCCTGG 22.6 NGS InDel allele freq 1000pg Cas9, 12.5pg gRNA, pool of 8 gRNAs 
gjd2a GAGAATGGACCATACTAGAGAGG 22.5 NGS InDel allele freq 1000pg Cas9, 12.5pg gRNA, pool of 8 gRNAs 
gjd2b GACAATTCTCGAGCGTCTCCTGG 38.5 qPCR abundance 1000pg Cas9, 12.5pg gRNA 
nlgn1 GTGCTGCGTAGGGAACCCCCAGG 13.9 NGS InDel allele freq 1000pg Cas9, 12.5pg gRNA, pool of 8 gRNAs 
nlgn2a GGGCTATGCCCACAATTCAGAGG 27.5 NGS InDel allele freq 1000pg Cas9, 12.5pg gRNA, pool of 8 gRNAs 
nlgn2b GGTGACCATAGGGTGCTTGGCGG 33.9 NGS InDel allele freq 1000pg Cas9, 12.5pg gRNA, pool of 8 gRNAs 
nlgn3a GGGACCAGTGGACCAGTACCTGG 17.1 NGS InDel allele freq 1000pg Cas9, 12.5pg gRNA, pool of 8 gRNAs 
nlgn3b GGGACCTGTGGATCAATATCTGG 32.2 NGS InDel allele freq 1000pg Cas9, 12.5pg gRNA, pool of 8 gRNAs 
nlgn4a GGATTGTGCTTGCGGCTGCGTGG 38.1 NGS InDel allele freq 1000pg Cas9, 12.5pg gRNA, pool of 8 gRNAs 
nlgn4b GAAGCTCCGCGGGCTCCGTGTGG 46.2 NGS InDel allele freq 1000pg Cas9, 12.5pg gRNA, pool of 8 gRNAs 
nrxn1a_L GGGGCCAGCATGGAGTTCACTGG 78.7 NGS InDel allele freq 1000pg Cas9, 12.5pg gRNA, pool of 8 gRNAs 
nrxn1a_S GGCTGCCACCGCTGACTTTGGGG 19.6 NGS InDel allele freq 1000pg Cas9, 12.5pg gRNA, pool of 8 gRNAs 
nrxn1b_L GGATCTAGTCTCAGGTTTACAGG 24.1 NGS InDel allele freq 1000pg Cas9, 12.5pg gRNA, pool of 8 gRNAs 
nrxn1b_S GGAGATCATCACTCGGCGTTTGG 5.7 qPCR abundance 1000pg Cas9, 12.5pg gRNA 
nrxn2a_L GTCACCGGCCTTCGTTTGGCTGG 59.3 qPCR abundance 1000pg Cas9, 12.5pg gRNA 
nrxn2a_S GGCGCTATCTCTGGCCTTGTTGG 23.1 NGS InDel allele freq 1000pg Cas9, 12.5pg gRNA, pool of 8 gRNAs 
nrxn2b_L GTGGGCACGGTACTCTCGGTGGG 58.8 NGS InDel allele freq 1000pg Cas9, 12.5pg gRNA, pool of 8 gRNAs 
nrxn2b_S GGAGCTACAGCCGGGGCTTGTGG 23.2 NGS InDel allele freq 1000pg Cas9, 12.5pg gRNA, pool of 8 gRNAs 
nrxn3a_L GTAAACTCCAGGCCCAAGCAGGG 33.5 NGS InDel allele freq 1000pg Cas9, 12.5pg gRNA, pool of 8 gRNAs 
nrxn3a_S GATAATTCAGTGGTCGCCGCTGG 12.8 NGS InDel allele freq 1000pg Cas9, 12.5pg gRNA, pool of 8 gRNAs 
nrxn3b_L GGTTTGGGCCTGGAGTTCACAGG 26 NGS InDel allele freq 1000pg Cas9, 12.5pg gRNA, pool of 8 gRNAs 
nrxn3b_S GGTGCGTGTTCGGAGCCGTATGG 57.1 NGS InDel allele freq 1000pg Cas9, 12.5pg gRNA, pool of 8 gRNAs 
tjp1a_B GGAAAGTGTCGGATTGAGGCTGG 29 NGS InDel allele freq 1000pg Cas9, 12.5pg gRNA, pool of 8 gRNAs 
tjp1a_L GCATACGGTGACTCTTCACAGGG 27.3 NGS InDel allele freq 1000pg Cas9, 12.5pg gRNA, pool of 8 gRNAs 
tjp1b_B GTGGGCTTGAGGCTCGCTGGGGG 49.5 NGS InDel allele freq 1000pg Cas9, 12.5pg gRNA, pool of 8 gRNAs 
tjp1b_L GAGTGCAGCAATGGATGAGACGG 29.2 NGS InDel allele freq 1000pg Cas9, 12.5pg gRNA, pool of 8 gRNAs 
tjp2a GGCTTTGGCCTAGCGGTGTCTGG 18 NGS InDel allele freq 1000pg Cas9, 12.5pg gRNA, pool of 8 gRNAs 
tjp2b GTTTGGATTGTCCCGGCCGCCGG 31.5 NGS InDel allele freq 1000pg Cas9, 12.5pg gRNA, pool of 8 gRNAs 
tjp3 GATTCCCACCGGTCCCGCCATGG 52.9 NGS InDel allele freq 1000pg Cas9, 12.5pg gRNA, pool of 8 gRNAs 
Showing 48 items